|  Help  |  About  |  Contact Us

Allele : Ankrd45<em1(IMPC)J> ankyrin repeat domain 45; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5812890 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ankrd45
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ankrd45-8103J-F3985 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTGGGAAGATGTGTGTA, ATGCAGGGACTTGGGTTTTT, GAGTTATCCACTCATAAAGA and TTCTGCCCGGAATTATAGGT, which resulted in a 697 bp deletion beginning at Chromosome 1 positive strand position 161,150,840 bp, CCAAGTCCCTGCATCCCACA and ending after GTTGGTTATAATGTTAGAAA at 161,151,536 bp (GRCm38/mm10). This mutation deletes exon 2 and 344 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp del (A) 23 bp before the 697 bp deletion that will not effect the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 25 and early truncation 24 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ankrd45<em1J>,
  • Ankrd45<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories