|  Help  |  About  |  Contact Us

Allele : Sec14l1<em1(IMPC)J> SEC14-like lipid binding 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5812905 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sec14l1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Sec14l1-8157J-M2381 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGATGTTGTGTGAACTG, ATGGTTCTCACTGGGTGACA, GCCGTGGGTTCCCCTCAGCG and TCACTGACCGCCACCAACCA, which resulted in a 608 bp deletion beginning at Chromosome 11 positive strand position 117,143,718 bp, TTGTGTGAACTGGGGAGTCT, and ending after ACCCCTTTAGTCTTGGCTGC at 117,144,325 bp (GRCm38/mm10). This mutation deletes exon 6 and 373 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (CACCCA) and a 1 bp (G) insertion 121 bp before the 608 bp exon deletion that will not alter the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 158 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Sec14l1<em1J>,
  • Sec14l1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories