| Primary Identifier | MGI:5812905 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sec14l1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sec14l1-8157J-M2381 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGATGTTGTGTGAACTG, ATGGTTCTCACTGGGTGACA, GCCGTGGGTTCCCCTCAGCG and TCACTGACCGCCACCAACCA, which resulted in a 608 bp deletion beginning at Chromosome 11 positive strand position 117,143,718 bp, TTGTGTGAACTGGGGAGTCT, and ending after ACCCCTTTAGTCTTGGCTGC at 117,144,325 bp (GRCm38/mm10). This mutation deletes exon 6 and 373 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (CACCCA) and a 1 bp (G) insertion 121 bp before the 608 bp exon deletion that will not alter the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 158 and early truncation 2 amino acids later. |
