|  Help  |  About  |  Contact Us

Allele : Reps2<em1(IMPC)J> RALBP1 associated Eps domain containing protein 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5812581 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Reps2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Reps2-8146J-M5750 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTTTAGCAAGGTTATAGTG, TAGGATTAGATCCTTTCAGC, GTTTTTCCTGTTATGAAATG and AAAATAAAGATGACAAACGC, which resulted in a 616 bp deletion beginning at Chromosome X negative strand position 162,565,597 bp, TTCAAAAGAGGAGGAATAAT, and ending after TCAGCTGGCAGTTAAGGTAG at 162,564,982 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp insertion (AT) before the deletion and a 20 bp deletion (TATTCTTTAGCAAGGTTATA) after the 616 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 78 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Reps2<em1J>,
  • Reps2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories