| Primary Identifier | MGI:5812587 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc26a10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Slc26a10-8158J-F2393 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTGGCAGATATATCGTG, ATTGTGTTGGTCCTTTTCGG, GGTCTTCTAAGAGAGCGGAT and GCAGCAGCCAGGAACCGATG, which resulted in a 444 bp deletion beginning at Chromosome 10 positive strand position 127,178,593 bp, CGATATATCTGCCACTCCGG, and ending after CTGGTGCAGCAGCCAGGAAC at 127,179,036 bp (GRCm38/mm10). This mutation deletes exon 3 and 286 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 159 and early truncation 144 amino acids later. |
