|  Help  |  About  |  Contact Us

Allele : C2cd2<em1(IMPC)J> C2 calcium-dependent domain containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5817198 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  C2cd2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project C2cd2-8190J-M1399 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTTCACTATATTTCTGCAG, CTAATGGGCTTGGGGTCCAA, AGGATGTGTGAGGTTGGCCA and ACAGAGTCATCACTATTTGC, which resulted in a 353 bp deletion beginning at Chromosome 16 negative strand position 97,883,448 bp CTGGCCAACCTCACACATCC, and ending after GGGCTTGGGGTCCAAAGGCC at 97,883,096 bp (GRCm38/mm10). This mutation deletes exon 6 and 229 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 11 bp deletion (ATTTGCAGGTT) 159 bp before the 353 bp deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 236 and early truncation 9 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • C2cd2<em1J>,
  • C2cd2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories