| Primary Identifier | MGI:5817198 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | C2cd2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project C2cd2-8190J-M1399 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTTCACTATATTTCTGCAG, CTAATGGGCTTGGGGTCCAA, AGGATGTGTGAGGTTGGCCA and ACAGAGTCATCACTATTTGC, which resulted in a 353 bp deletion beginning at Chromosome 16 negative strand position 97,883,448 bp CTGGCCAACCTCACACATCC, and ending after GGGCTTGGGGTCCAAAGGCC at 97,883,096 bp (GRCm38/mm10). This mutation deletes exon 6 and 229 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 11 bp deletion (ATTTGCAGGTT) 159 bp before the 353 bp deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 236 and early truncation 9 amino acids later. |
