|  Help  |  About  |  Contact Us

Allele : Gsg1l<em1(IMPC)J> GSG1-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5817921 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gsg1l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Gsg1l-8187J-M1359 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAGAGTCTGGTACCTGA, AGCCAGGATGAGGTGGACAG, CTAACAGTTCAGCTGGCAAG and CCCTTTCCAAGTTTAAGCAA, which resulted in a 106 bp deletion beginning at Chromosome 7 negative strand position 125,923,714 bp CTTAAACTTGGAAAGGGCTA, followed by 37 retained endogenous bases (TGGCTGGGGATGGGAGGTATCCTAGAGATGGGACAAG) followed by a second deletion of 303 bp that ends after ATGAGGTGGACAGGGGTGAG at 125,923,269 bp (GRCm38/mm10). In addition there is a 3 bp insertion (AGG)and a 6 bp deletion (CATGGC) 63 bp before the large interrupted deletion that will not alter the effects of the mutation. This mutation deletes exon 4 and 297 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 45 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Gsg1l<em1J>,
  • Gsg1l<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories