| Primary Identifier | MGI:5817343 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpx6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gpx6-8181J-F8998 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACCATCTATGGGCACCC, GGTTTACCAACTATCGAGTG, ACACATCTTGGGGAAAGCCT and AGATAGTTGTGGCATTAATG, which resulted in a 576 bp deletion beginning at Chromosome 13 positive strand position 21,313,423 bp CGAGTGAGGTCACAGCTCCC, and ending after TCCATGCTTGAGCTCCAAGG at 21,313,998 bp (GRCm38/mm10). This mutation deletes exon 2 and 422 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 1 amino acid later. |
