|  Help  |  About  |  Contact Us

Allele : Mccc2<em1(IMPC)J> methylcrotonoyl-Coenzyme A carboxylase 2 (beta); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5817349 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mccc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Mccc2-8043J-M4937 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGTACAGAAGACACGCTG, ATTTAGAAGCATTTGTTGAT, GTAAAGTGCCGTGTTTGGCG and ACAATGCTCCACGCCAAACA, which resulted in a 511 bp deletion beginning at Chromosome 13 positive strand position 99,993,340 bp, CATGCTGGATGCTGCCATGC, and ending after GCAGATCTCTCAGTTTGGAG at 99,993,850 bp (GRCm38/mm10). This mutation deletes exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 34 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mccc2<em1J>,
  • Mccc2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories