| Primary Identifier | MGI:5819211 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rad54l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TTGGTGCACTTTGTAAATTC, which resulted in a 4 bp deletion (TTCT) at Chromosome 4 negative strand position 116,105,771 bp and ending after 116,105,767 bp(GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 342 and early truncation 18 amino acids later. |
