| Primary Identifier | MGI:5824335 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr505 |
| Strain of Origin | (C57BL/6 x CBA)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The TES (testis specific enhancer of Sox9) regulatory region 10-13 kb upstream of the gene was targeted with a pair of single guide RNAs (sgRNAs) using the CRISPR/Cas9 system. The proximal sgRNA (equivalent to GGGAACATTGGCAGGGCCCT) was targeted to sequence 20 bp downstream of the 3' end of the region. The distal sgRNA (equivalent to GAGGTGTGTGGAAGCGGGC) was targeted to sequence 25 bp upstream of the 5' end of the region. Two stable lines were established that carried the 3194 bp deletion between the Cas9 cleavage sites. This 3194 bp deletion deletes the entire 3161 bp TES sequence. |
