|  Help  |  About  |  Contact Us

Allele : Pdzrn3<em1(IMPC)J> PDZ domain containing RING finger 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825050 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pdzrn3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Pdzrn3-8311J-M0809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTAGTTAAGTAACCCGCA, AGGAGGCCGGAGATGCACCC, ACTTCCTCGGAAAATGCCCG and CCCTCCCTATGGCCAAAAGA, which resulted in a 1147 bp deletion beginning at Chromosome 6 negative strand position 101,378,125 bp AAAGAGGGTCGTGAGGCCCC, and ending after CCAGCTGTATCACTCCGTGC at 101,376,979 bp (GRCm38/mm10). This mutation deletes exon 1 and 415 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null unless there is an alternative ATG that is used.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pdzrn3<em1J>,
  • Pdzrn3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories