| Primary Identifier | MGI:5823410 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Alg9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Alg9-8257J-M6224 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATCAGGAAGGTCCTGCTA, TTAGTGTGTACCTTAGAAGC, TCGCCTAAATTTGAGCTGCT and TTGATCTTGATTTGGTACTT, which resulted in a 484 bp deletion beginning at Chromosome 9 negative strand position 50,776,825 bp, GTACCAAATCAAGATCAAAG, and ending after CGTCCACTTCCTGCTTCTAA at 50,776,342 bp (GRCm38/mm10). This mutation deletes exon 2 and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 51 amino acids later. |