|  Help  |  About  |  Contact Us

Allele : Tbc1d8<em1(IMPC)J> TBC1 domain family, member 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5823470 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tbc1d8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tbc1d8-8160J-M2435 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGGTGCTAAGTACCCCT, ACACTTTTGCTTAATTACAT, CCTTCAGTCTAACTGTTGTC and GTAAGAACCCAACCTTGTTT, which resulted in a 449 bp deletion beginning at Chromosome 1 negative strand position 39,405,659 bp, AACAAGGTTGGGTTCTTACA, and ending after GGTACTTAGCACCGCTTCCG at 39,405,211 bp (GRCm38/mm10). This mutation deletes exon 4 and 220 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp deletion (AC) 80 bp before the 449 bp deletion that will not effect the results of this deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tbc1d8<em1J>,
  • Tbc1d8<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories