| Primary Identifier | MGI:5825112 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Alg8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Alg8-8256J-M6218 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGTCTCAGAGATATCCAA, TCTCAGGCAACCGCACGAAA, GCAGGCAGTTGCTCTACATG and CAGTTAACAGAGATCCACTT, which resulted in a 571 bp deletion beginning at Chromosome 7 negative strand position 97,373,999 bp CAGGCAGTTGCTCTACATGG, and ending after GTTCTCAGGCAACCGCACGA at 97,373,429 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion 19 bp after the deletion that will not affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence and early truncation after residue 31. |