|  Help  |  About  |  Contact Us

Allele : Efhd1<em1(IMPC)J> EF hand domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825125 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Efhd1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Efhd1-8204J-F5406 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCGGAGGCTTGCAAAGCAGG, GGAGGTGCCTTACTGTGAAG, AACCAGGGAGCATTCTCAAT and TGCCGATTGAGAATGCTCCC, which resulted in a 540 bp deletion beginning at Chromosome 1 negative strand position 87,289,692 bp ATTCTCAATCGGCAGATCCA, and ending after GGACCCAACACCTCCAAATG at 87,289,147 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence (retains 6 bp CTCCGC at 87289348-87289343) including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 58 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Efhd1<em1J>,
  • Efhd1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories