| Primary Identifier | MGI:5825125 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Efhd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Efhd1-8204J-F5406 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCGGAGGCTTGCAAAGCAGG, GGAGGTGCCTTACTGTGAAG, AACCAGGGAGCATTCTCAAT and TGCCGATTGAGAATGCTCCC, which resulted in a 540 bp deletion beginning at Chromosome 1 negative strand position 87,289,692 bp ATTCTCAATCGGCAGATCCA, and ending after GGACCCAACACCTCCAAATG at 87,289,147 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence (retains 6 bp CTCCGC at 87289348-87289343) including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 58 amino acids later. |
