|  Help  |  About  |  Contact Us

Allele : Chmp7<em1(IMPC)J> charged multivesicular body protein 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825131 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Chmp7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Chmp7-8200J-F4216 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATGTAAAAATAACCCA, GCTGATTACTTCCGGACAGT, GTTAATATAATGCCTCTGAG and TGCGACAGACAGCCTGTCCT, which resulted in a 385 bp deletion beginning at Chromosome 14 negative strand position 69,730,348 bp CAGGCTGTCTGTCGCATTAC, and ending after TAGGGTTATATATTCCTTGG at 69,729,964 bp (GRCm38/mm10). This mutation deletes exon 2 and 213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 25 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Chmp7<em1J>,
  • Chmp7<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories