|  Help  |  About  |  Contact Us

Allele : Tbc1d16<em1(IMPC)J> TBC1 domain family, member 16; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825264 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tbc1d16
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tbc1d16-8341J-M1322 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGGCTTAGGGCCACCACA, GCCTCACTACCCAGCCTGGT, TGGCTTGTCGTTCTAAATGG and AGAAAGCCATTGCTGACTGG, which resulted in a 958 bp deletion beginning at Chromosome 11 negative strand position 119,209,527 bp, GACTGGAGGAGACCCAAGTG, and ending after CAGCCTCACTACCCAGCCTG at 119,208,570 bp (GRCm38/mm10). This mutation deletes exon 3 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel 26 bp after the deletion (AGCCAAGA insertion/TTTAG deletion) that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 145 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tbc1d16<em1J>,
  • Tbc1d16<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories