| Primary Identifier | MGI:5825264 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tbc1d16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tbc1d16-8341J-M1322 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGGCTTAGGGCCACCACA, GCCTCACTACCCAGCCTGGT, TGGCTTGTCGTTCTAAATGG and AGAAAGCCATTGCTGACTGG, which resulted in a 958 bp deletion beginning at Chromosome 11 negative strand position 119,209,527 bp, GACTGGAGGAGACCCAAGTG, and ending after CAGCCTCACTACCCAGCCTG at 119,208,570 bp (GRCm38/mm10). This mutation deletes exon 3 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel 26 bp after the deletion (AGCCAAGA insertion/TTTAG deletion) that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 145 amino acids later. |
