| Primary Identifier | MGI:5825311 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Xkr4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Xkr4-8176J-F8924 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCCCAATTCAGAAACCAAA, CCTCCAGCTGTCACTTTAAC, ACAGTCTTACTAGCTCAGTT and GTACGAAAGGAAAATGACTT, which resulted in a 278 bp deletion beginning at Chromosome 1 negative strand position 3,421,962 bp, CTTTGGAGTTTGAATTTCAA, and ending after AAGGTAAGGATTTGCCATTT at 3,421,685 bp (GRCm38/mm10). This mutation deletes exon 2 and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (TTTAAC) in the intron 95 bp before the deletion that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 266 and early truncation 26 amino acids later. |
