|  Help  |  About  |  Contact Us

Allele : Xkr4<em1(IMPC)J> X-linked Kx blood group related 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825311 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Xkr4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Xkr4-8176J-F8924 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCCCAATTCAGAAACCAAA, CCTCCAGCTGTCACTTTAAC, ACAGTCTTACTAGCTCAGTT and GTACGAAAGGAAAATGACTT, which resulted in a 278 bp deletion beginning at Chromosome 1 negative strand position 3,421,962 bp, CTTTGGAGTTTGAATTTCAA, and ending after AAGGTAAGGATTTGCCATTT at 3,421,685 bp (GRCm38/mm10). This mutation deletes exon 2 and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (TTTAAC) in the intron 95 bp before the deletion that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 266 and early truncation 26 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Xkr4<em1J>,
  • Xkr4<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele