|  Help  |  About  |  Contact Us

Allele : Bckdhb<em1(IMPC)J> branched chain ketoacid dehydrogenase E1, beta polypeptide; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825325 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Bckdhb
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Bckhb-8188J-M1369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAATCCCAGGTATCTCAA, CAATACGCATCTGAAAATGA, GCAGTTCGCATTTTGTAGAG and TGAGGGTCTCCAGCTTTCCG, which resulted in a 528 bp deletion beginning at Chromosome 9 positive strand position 83,988,526 bp, TTGAGATACCTGGGATTTGC, and ending after GCAGTTCGCATTTTGTAGAG at 83,989,053 bp (GRCm38/mm10). This mutation deletes exon 4 and 394 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 13 amino acids later. Western blot analysis confirmed the absence of the protein in the liver, heart and brain of homozygous mutant neonates.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Bckdhb<->,
  • Bckdhb<em1J>,
  • Bckdhb<em1J>,
  • Bckdhb<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories