|  Help  |  About  |  Contact Us

Allele : Rnf24<em1(IMPC)J> ring finger protein 24; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5825334 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnf24
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Rnf24-8318J-M9794 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCACTCCATTAAGTCAG, TCTGTGGTATAAACTGACAA, ATTTCTCTAGAACTTAAGAG and GTACTATCCCATGGTTCAGT, which resulted in a 344 bp deletion beginning at Chromosome 2 negative strand position 131,308,577 bp, TGGTTCAGTGGGAACTCTCT, and ending after CAGTATTTGTCGAAGAAAAA at 131,308,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 301 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (GAACTTAAGAGTGGG) 10 bp before the 344 bp deletion and an 8 bp deletion (TTTGATGT) 57 bp before the 344 bp deletion, neither of which are expected to alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 1 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rnf24<em1J>,
  • Rnf24<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories