|  Help  |  About  |  Contact Us

Allele : Fbxo10<em1(IMPC)J> F-box protein 10; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5827555 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fbxo10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Fbxo10- 8390J-M4753 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAATCTCCCGAGGAGCAGG, AGTGCCAGATAGTCTGGGCA, GTACCAAGACGGACACAGCC and GCTGTGTGCTCAGGAATGGC, which resulted in a 512 bp deletion beginning at Chromosome 4 positive strand position 45,048,176 bp, GGAGGCACATGGTTGCCTTT, and ending after AGGACAAAACACCACCAGCC at 45,048,687 bp (GRCm38/mm10). This mutation deletes exon 5 and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 519 and early truncation 28 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Fbxo10<em1J>,
  • Fbxo10<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories