|  Help  |  About  |  Contact Us

Allele : Kynu<em1(IMPC)J> kynureninase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5827722 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kynu
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Kynu-8351J-M627 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCATAACTTAAACCCACAG, CTTCCAATCACAAATAGCCA, CTTCTTTGCTGGACATTAAA and TGGAGTTACACCTTTTAACT, which resulted in a deletion of 340 bp in total. This deletion begins at Chromosome 2 positive strand position 43,581,141 bp, CCTCTGTGGGTTTAAGTTA, removes 19 bp, then retains 3 endogenous bases (TGC) in the intron, and then removes 321 bp, ending after GATGTAAGTACCAAGTTAAA at 43,581,483 bp (GRCm38/mm10). This mutation deletes exon 3 and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Kynu<em1J>,
  • Kynu<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories