|  Help  |  About  |  Contact Us

Allele : Rr40<tm1.1Ptsn> regulatory region 40; targeted mutation 1.1, Part Peterson
Primary Identifier  MGI:5829272 Allele Type  Targeted
Attribute String  Modified regulatory region, Null/knockout Gene  Rr40
Transmission  Germline Strain of Origin  129S6/SvEvTac
Is Recombinase  false Is Wild Type  false
molecularNote  The 45 bp (CTGTCACGGAAACCCCCACGTGTGATGGAAAGTCCAAAATTGTAC) Aire enhancer region within the conserved noncoding sequence 1 (CSN1) region, including two Nfkb1 binding sites, was replaced with a floxed neomycin resistance cassette. Cre-mediated recombination removed the selection cassette.
  • mutations:
  • Intragenic deletion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories





MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom