|  Help  |  About  |  Contact Us

Allele : Sel1l3<em1(IMPC)J> sel-1 suppressor of lin-12-like 3 (C. elegans); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5829466 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sel1l3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Sel1l3-8391J-F4781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGTCATCGCACAACAGCA, CAAGAATGTGCTGTGCCACG, ATTCCCGAGCTGGCTTCCGA and AACATCTGCTGATCAAAATG, which resulted in a 928 bp deletion beginning at Chromosome 5 negative strand position 53,200,761 bp CGGAAGCCAGCTCGGGAATG, and ending after GCCGGTGTCATCGCACAACA at 53,199,834 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 9 bp insertion (TTTTTTTTT) at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 19 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Sel1l3<em1J>,
  • Sel1l3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories