| Primary Identifier | MGI:5829466 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sel1l3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sel1l3-8391J-F4781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGTCATCGCACAACAGCA, CAAGAATGTGCTGTGCCACG, ATTCCCGAGCTGGCTTCCGA and AACATCTGCTGATCAAAATG, which resulted in a 928 bp deletion beginning at Chromosome 5 negative strand position 53,200,761 bp CGGAAGCCAGCTCGGGAATG, and ending after GCCGGTGTCATCGCACAACA at 53,199,834 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 9 bp insertion (TTTTTTTTT) at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 19 amino acids later. |
