| Primary Identifier | MGI:5883322 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Itgb3bp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Itgb3bp-8308J-F0692 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATAGCTCTTGTTGCAGCT, TTATAATTGATAGTAGCTGA, AAGTAGCTACCTTATTTGAG and GAGTTTTCATGAGTTACTTA, which resulted in a 2 part deletion of 558 bp in total. This deletion begins at Chromosome 4 negative strand position 99,802,399 bp TTTGAGAGGAATACTGGTCA, removes 222 bp then retains 4 endogenous exonic bases (CTAC) and ends after TATGGCCTGACTGCCTTCAG at 99,801,838 bp (GRCm38/mm10). This mutation deletes 132 bp in exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 7 amino acids later. |
