| Primary Identifier | MGI:5883339 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp189 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp189-8388J-M4746 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACTTCTCCCACTTTCAG, CCATGCTCCCATTCACTAGG, CCTTTGCTAACAAGGAAGCG and GTAGAAAGATCCGAATCAGA, which resulted in a two-part deletion of 361 bp in total. This deletion begins at Chromosome 4 positive strand position 49,522,267 bp, deletes 5 bp TGAAT, retains 3 endogenous bp (GGG) in the intron and then removes 356 bp ending after AACTCTGGTCTCCCTCGCTT at 49,522,630 bp (GRCm38/mm10). This mutation deletes exon 2 and 276 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 2 amino acids later. |
