| Primary Identifier | MGI:5883410 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gimap3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gimap3-8295J-F2029 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTGCCCCCAAAAAGAA, TAAGCCAGCAACAGGCTAGC, GCAATGGCCTATCATCTCAG and GTAATGTTGGTAAAGCAGAG, which resulted in a 930 bp deletion beginning at Chromosome 6 negative strand position 48,766,201 bp ATCATCTCAGAGGAAGGTCC, and ending after AAGCCTATAGGTGCTACCTG at 48,765,272 bp (GRCm38/mm10). This mutation deletes 695 bp of exon 2 and 235 bp of intron 1 sequence including the splice acceptor. In addition there is an 8 bp deletion (GCTAGCAG) 304 bp after the 930 bp deletion that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 14 amino acids later, possibly due to read through of intron 1. |
