|  Help  |  About  |  Contact Us

Allele : Ccng2<em1(IMPC)J> cyclin G2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5883421 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccng2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ccng2-8345J-F4819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATCTAAGAGAAGCAACA, CTGAAATGTAAAATGATTGT, GTCTGTCCAGACTTTCGACT and GCAGCCACGCTGAAGGCCTG, which resulted in a 407 bp deletion beginning at Chromosome 5 positive strand position 93,270,724 bp ATGGCATTATTTCAAGCGTC, and ending after AGTCTGTCCAGACTTTCGAC at 93,271,130 bp (GRCm38/mm10). This mutation deletes exon 4 and 156 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ccng2<em1J>,
  • Ccng2<em1J>,
  • Ccng2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories