|  Help  |  About  |  Contact Us

Allele : Esd<em1(IMPC)J> esterase D/formylglutathione hydrolase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5897850 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Esd
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Esd-8515J-1863F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGTGCGTCTACACACAA, CTACTTTTTGAGATACATAA, GCGATGTTGAGAGATAACCT and TTATTAGCTGATGACCAACT, which resulted in a 427 bp deletion beginning at Chromosome 14 positive strand position 74,741,754 bp, TGTATCTCAAAAAGTAGAAG, and ending after TATTAGCTGATGACCAACTG at 74,742,180 bp (GRCm38/mm10). This mutation deletes exon 5 and 302 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp insertion (GT) at the site of the deletion and a single bp insertion (T) in the intron 194 bp downstream of the deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 85 and early truncation 61 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories