|  Help  |  About  |  Contact Us

Allele : Apol8<em1(IMPC)J> apolipoprotein L 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5897852 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Apol8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Apol8-8505J-5445F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAAGCTGAGAGCCATCGGA, ACTGGGTGAGGAAGACACGG, TGGTCCCACCTAAGGAGGCG and TCCCAACACCAGCTCTCCAG, which resulted in a 522 bp deletion beginning at Chromosome 15 negative strand position 77,753,103 bp, GCTCTCCAGGGGTGGGTGTC, and ending after AAGCTGAGAGCCATCGGAAG at 77,752,582 bp (GRCm38/mm10). This mutation deletes exon 3 and 395 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 42 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories