| Primary Identifier | MGI:5897840 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Del(7)3J |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This deletion was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACAGTCTACACAAGTCCT, ACTTGGTTACCACAAAGAGG, GGATTTAGCAACTGCTACAG and CAACTGCTACAGAGGACACT, which resulted in a 1488 bp deletion beginning at Chromosome 7 positive strand position 30,554,158bp, CCTCGGCAGCAGCACTGTAA, and ending after GGATTTAGCAACTGCTACAG at 30,555,645 bp (GRCm38/mm10) that disrupts both Hspb6 and Lin37. From Hspb6 ENSMUSE00001259506 and ENSMUSE00000803270 (exons 2 and 3) are deleted along with 390 bp of flanking intronic sequence including the splice acceptor and donor, which is predicted to cause a change in amino acids sequence after residue 67 and early truncation 20 amino acids later due to read through. From Lin37 ENSMUSE00000675817 (exon 9) is deleted along with 36 bp of the flanking intron, and this exon deletion is predicted to cause an early stop after residue 208 in Lin37. In addition, there is a 2 bp (AG) deletion 84 bp before the 1488 bp deletion and a single bp insertion (T) at the deletion site. |