|  Help  |  About  |  Contact Us

Allele : Nt5dc2<em1(IMPC)J> 5'-nucleotidase domain containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5902345 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nt5dc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Nt5dc2-8541J-1639M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCAGTGTCCTAGTTGAG, ATACTTAGTCAAGGGCCCCT, GGCTAGAGCCAACGGCACCA and GGTCGGCCCTGGACTGTGCA, which resulted in a 321 bp deletion beginning at Chromosome 14 positive strand position 31,136,450 bp, CAGGGGCCCTTGACTAAGTA, and ending after GGGGCTAGAGCCAACGGCAC at 31,136,770 bp (GRCm38/mm10). This mutation deletes exon 9 and 239 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 179 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories