| Primary Identifier | MGI:5902368 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cybb |
| Strain of Origin | NOD.Cg-Prkdc<scid> Il2rg<tm1Wjl>/SzJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 genome engineering, Cybb is targeted with a specific single guide RNA (GGTACTTACAATGACAAAGA) targeted to exon 1. The mutation is identified as a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter. |
