|  Help  |  About  |  Contact Us

Allele : Nt5dc3<em1(IMPC)J> 5'-nucleotidase domain containing 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5901849 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nt5dc3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Nt5dc3-8542J-8383M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGGGTGGCTTCTAAACAGA, TGTCATCTCCTGGGATAGAT, GGTCTGGGCATGAATGCGCA and TCTACTCTTCAGACACCAAA, which resulted in a 343 bp deletion beginning at Chromosome 10 positive strand position 86,804,714 bp, CTCTGTTTAGAAGCCACCCA, and ending after ATTCATGCCCAGACCCTGCC at 86,805,056 bp (GRCm38/mm10). This mutation deletes exon 2 and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories