| Primary Identifier | MGI:5901849 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nt5dc3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Nt5dc3-8542J-8383M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGGGTGGCTTCTAAACAGA, TGTCATCTCCTGGGATAGAT, GGTCTGGGCATGAATGCGCA and TCTACTCTTCAGACACCAAA, which resulted in a 343 bp deletion beginning at Chromosome 10 positive strand position 86,804,714 bp, CTCTGTTTAGAAGCCACCCA, and ending after ATTCATGCCCAGACCCTGCC at 86,805,056 bp (GRCm38/mm10). This mutation deletes exon 2 and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later. |