| Primary Identifier | MGI:5901853 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Larp1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Larp1b-8531J-915F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAACCTCCAGATCACACG, CAGTAGTCCTCTGACACGAT, ATATTTTCTCAATATCCTAG and AATGTCATTGCCTAATGAGA, which resulted in a 528 bp deletion beginning at Chromosome 3 positive strand position 40,970,239 bp GTGATCTGGAGGTTATATGC, and ending after AAATGTCATTGCCTAATGAG at 40,970,766 bp (GRCm38/mm10). In addition there is a 9 bp insertion (ATGAAAAAA) at the deletion site that will not alter the results of the exon deletion. This mutation deletes exon 7 and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 28 amino acids later. |
