| Primary Identifier | MGI:5901857 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Elmod3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Elmod3-8514J-1055M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACCTAGCTCCTAACCCA, ACAGCAAGTGGACTTCTTGG, GCTGGAAGACTCTATTCTGA and CGCAGCTCTTCCCACCCACT, which resulted in a 351 bp deletion beginning at Chromosome 6 negative strand position 72,586,628 bp, TCCATCAGAATAGAGTCTTC, and ending after AACCCTGGGTTAGGAGCTAG at 72,586,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 281 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 1 amino acid later. |
