|  Help  |  About  |  Contact Us

Allele : Elmod3<em1(IMPC)J> ELMO/CED-12 domain containing 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5901857 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Elmod3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Elmod3-8514J-1055M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACCTAGCTCCTAACCCA, ACAGCAAGTGGACTTCTTGG, GCTGGAAGACTCTATTCTGA and CGCAGCTCTTCCCACCCACT, which resulted in a 351 bp deletion beginning at Chromosome 6 negative strand position 72,586,628 bp, TCCATCAGAATAGAGTCTTC, and ending after AACCCTGGGTTAGGAGCTAG at 72,586,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 281 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele