| Primary Identifier | MGI:7779649 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr308 |
| Strain of Origin | B6SJLF1/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | E-box E1 in the Tcra enhancer was targeted using sgRNAs (equivalent to TCCATTTCCTGTTCTACTTC and CCCACTTCCCTCCAGGTGTTT) and an ssODN template with CRISPR/Cas9 technology, resulting in the deletion of TTCCCTCCAGGTG (GRCm39:chr14:54464896-54464908). |