|  Help  |  About  |  Contact Us

Allele : Rr308<em1Krg> regulatory region 308; endonuclease-mediated mutation 1, Michael S Krangel

Primary Identifier  MGI:7779649 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr308
Strain of Origin  B6SJLF1/J Is Recombinase  false
Is Wild Type  false
molecularNote  E-box E1 in the Tcra enhancer was targeted using sgRNAs (equivalent to TCCATTTCCTGTTCTACTTC and CCCACTTCCCTCCAGGTGTTT) and an ssODN template with CRISPR/Cas9 technology, resulting in the deletion of TTCCCTCCAGGTG (GRCm39:chr14:54464896-54464908).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Ealpha<deltaE1>,
  • Ealpha<deltaE1>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele