| Primary Identifier | MGI:7779650 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr308 |
| Strain of Origin | B6SJLF1/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | E-box E3 in the Tcra enhancer was targeted in cells containing the Rr308em1Krg allele using an sgRNA (GGCCTTCTTTTCTGCACCTG) with CRISPR/Cas9 technology, resulting in a deletion, resulting in the deletion of CAGGTG (GRCm39:chr14:54465103-54465108) (in addition to the existing deletion of TTCCCTCCAGGTG). |