|  Help  |  About  |  Contact Us

Allele : Msl3<em1(IMPC)J> MSL complex subunit 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5903077 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Msl3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Msl3-8574J-299M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTCAACTATATTCATACA, AGCTTGTGGAAACACTCTGT, AACTAAGTTTCTGTTCCGAA and GGATCCTATGGTTCACTGTT, which resulted in a 635 bp deletion beginning at Chromosome X negative strand position 168,670,594 bp, GCCACCACTGATGAACCCAA, and ending after TTTATACCCACAGAGTGTTT at 168,669,960 bp (GRCm38/mm10). This mutation deletes exon 5 and 543 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after residue 127.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories