| Primary Identifier | MGI:5903077 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Msl3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Msl3-8574J-299M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTCAACTATATTCATACA, AGCTTGTGGAAACACTCTGT, AACTAAGTTTCTGTTCCGAA and GGATCCTATGGTTCACTGTT, which resulted in a 635 bp deletion beginning at Chromosome X negative strand position 168,670,594 bp, GCCACCACTGATGAACCCAA, and ending after TTTATACCCACAGAGTGTTT at 168,669,960 bp (GRCm38/mm10). This mutation deletes exon 5 and 543 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after residue 127. |