| Primary Identifier | MGI:5903207 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rasgef1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rasgef1a-8583J-1847M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCGACTAGGCTTACAGCA, CTGCTGCTCTTAGTCCCAGA, TGACAGATCTGGTCCTCCCT and TGCCTGCTCAGAGGAGCCTG, which resulted in a 836 bp deletion beginning at Chromosome 6 positive strand position 118,088,863 bp, GAGAGACACAGGCCCTGCTG, and ending after ACAGATCTGGTCCTCCCTAG at 118,089,698 bp (GRCm38/mm10). This mutation deletes exons 11-12 and 639 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 408 and early truncation 4 amino acids later. |
